Association Between Gene Polymorphisms of RSPO2 of the Wnt Signaling Pathway and Schizophrenia in the Korean Population

Article information

Psychiatry Investig. 2025;22(12):1339-1349
Publication date (electronic) : 2025 December 4
doi : https://doi.org/10.30773/pi.2025.0020
1Department of Psychiatry, Kyung Hee University College of Medicine, Kyung Hee University Hospital, Seoul, Republic of Korea
2Department of Pharmacology, Kyung Hee University College of Medicine, Kyung Hee University Hospital, Seoul, Republic of Korea
Correspondence: Jong Woo Kim, MD, PhD Department of Psychiatry, Kyung Hee University Hospital, 26 Kyungheedaero, Dongdaemun-gu, Seoul 02447, Republic of Korea Tel: +82-2-958-8196, E-mail: psyjong@gmail.com
Received 2025 January 13; Revised 2025 May 19; Accepted 2025 August 18.

Abstract

Objective

The study aimed to investigate whether RSPO2 gene polymorphisms are associated with schizophrenia susceptibility, focusing on five specific single nucleotide polymorphisms (SNPs). Additionally, the study evaluated the expression of Rspo2 in a schizophrenic-like mouse model and examined its relationship with clinical symptoms.

Methods

The study included 159 schizophrenia patients and 448 controls. Clinical symptoms were assessed using the Operational Criteria Checklist for Psychotic Illness. Genotyping of five RSPO2 SNPs was performed to identify potential genetic associations with schizophrenia. Rspo2 mRNA expression levels were measured in the brains of MK-801-induced schizophrenic-like mice. Functional analysis of the rs374810 SNP was conducted using a luciferase assay to evaluate its effect on gene activity. Statistical analyses were used to compare genotype and allele frequencies and assess correlations with clinical outcomes.

Results

Significant associations were found between schizophrenia and two SNPs, rs374810 and rs423940. The A allele of rs374810 and the T allele of rs423940 were linked to an increased risk of schizophrenia (p=0.0049 and p=0.0044, respectively). Functional analysis revealed that the A allele of rs374810 significantly increased luciferase activity compared to the G allele, indicating a potential functional role. RSPO2 expression was also altered in the schizophrenic-like mouse model, suggesting its involvement in schizophrenia pathogenesis.

Conclusion

The findings indicate that RSPO2 gene polymorphisms, particularly rs374810 and rs423940, may contribute to schizophrenia susceptibility. Therefore, RSPO2 expression may be associated with the susceptibility to schizophrenia in the Korean population.

INTRODUCTION

The pathogenesis of schizophrenia remains unclear, and several hypotheses have been proposed. One example is the neurodevelopmental hypothesis, which suggests that schizophrenia is caused by the dysregulation of brain development [1]. The neurodevelopmental model of schizophrenia is supported by genetic, histological, and clinical data. Studies have shown that perinatal and obstetric complications [2], prenatal infections [3], and cognitive and motor symptoms during childhood and adolescence [2,4] are associated with schizophrenia, which indicates early deficits in brain function. Accumulated evidence has suggested that brain development might be disrupted in patients with schizophrenia [1,3-7]. A recent study indicated a genetic overlap between schizophrenia and neurodevelopmental disorders, such as autism-spectrum disorders, intellectual disability, and attention-deficit hyperactivity disorder [8]. Thus, the neurodevelopmental hypothesis has gained considerable support from the evidence linking early brain development disruptions in patients with schizophrenia.

One of the critical brain developmental signaling pathways is the Wnt pathway. During neurogenesis, Wnt signaling pathway is active in neural progenitors in the ventricular zone [9]. Activation of Wnt signaling pathway leads to the expansion of different neural precursor populations, while inhibition of Wnt signaling pathway leads to premature cell cycle cessation and precursor depletion [10]. Wnt signaling pathway is important for brain regionalization, hippocampus development, neuronal proliferation, synapse formation, and migration [11]. Dysregulation of Wnt signaling pathway could reduce the hippocampal volume and disorganize the forebrain structures and synaptic defects [12]. Thus, Wnt signaling pathway can be an important factor in disease etiology.

Two major intracellular WNT pathways exist: canonical (β-catenin-dependent) and non-canonical (β-catenin-independent). WNT/β-catenin signals are necessary for adult neurogenesis, neuronal plasticity, and synaptic maintenance [13]. In schizophrenia, dysregulated mRNA expression of WNT-related genes impacts the canonical pathway [6]. WNT-related molecules have been investigated for their potential association with schizophrenia. WNT1 expression is increased in schizophrenic brains [14] and is associated with the susceptibility to schizophrenia. WNT2 is located on chromosome 7q31.2 and shows a significant linkage to schizophrenia in the Genome Scan of European-American Schizophrenia Pedigrees [15]. There was also a positive association between schizophrenia and other Wnt-related genes, such as the Frizzled Class Receptor 3 (FZD3) gene locus [16]; rs2073665 single nucleotide polymorphism (SNP) of the Dickkopf Wnt signaling pathway inhibitor 4 (DKK4) [17]; rs9960767 SNP of the Transcription Factor 4 (TCF4) [18]; and rs9326555, rs10494251, rs1240083, rs672607, rs688325, and rs3766512 of the BCL9 transcription coactivator (BCL-9) [19].

R-spondin 2 (Rspo2), encoded by Rspo2, is a secreted ligand that enhances Wnt signaling pathway and activates β-catenin by binding to leucine-rich repeat-containing G protein-coupled receptor 4/5 (LGR4/5) [20]. Rspo2 promoted midbrain dopaminergic differentiation, resulting in a two-fold increase in the number of midbrain dopaminergic neurons in primary ventral midbrain cultures in mouse and human embryonic stem cell preparations [21]. This suggests that impaired neurodevelopment in neuronal cells contributes to the pathogenesis of schizophrenia. However, to date, no study has focused on the associations between RSPO2 and susceptibility to schizophrenia. This study aimed to investigate the involvement of RSPO2 in the pathophysiology of schizophrenia. To detect the alteration in the expression of RSPO2 genes in patients with schizophrenia, we measured the mRNA expression level of the gene in the brains of MK-801-injected schizophrenic-like mice. To identify the genetic involvement of RSPO2 in schizophrenia, we analyzed the association between SNPs of RSPO2 and schizophrenia.

METHODS

Animal model of schizophrenia

Male ICR mice (7 weeks old) were purchased from Orient Bio. The animals were housed in a controlled environment with a temperature maintained at 22±3°C, relative humidity at 50%±5%, and a 12-hour light-dark cycle with free access to food and water. Animal experiments were approved by the Institutional Animal Care and Use Committee of Kyung Hee University (KHSASP-20-279) and adhered to the Korean Academy of Medical Sciences guidelines. The mice were randomly assigned to either the control group or the MK-801 treatment group, each consisting of 5 animals. MK-801 (Sigma-Aldrich) was administered intraperitoneally at a dose of 0.5 mg/kg. One hour post-injection, pre-pulse inhibition (PPI) of the acoustic startle response was assessed to evaluate the effects of MK-801 treatment. Subsequent to the PPI assessment, mice were euthanized. The prefrontal cortex, hippocampus, and striatum were excised and weighed. Tissue samples were then stored at-70°C until further analysis.

PPI test

One hour following administration of MK-801 (0.5 mg/kg, i.p.), the PPI of the acoustic startle response in mice was assessed using SR-LAB startle chambers (San Diego Instruments). These startle chambers were designed to be sound-attenuated and featured a plexiglass cylinder mounted on a plexiglass platform connected to a piezoelectric accelerometer. A speaker at the top of the chamber emitted a constant background noise at 70 dB throughout the testing period.

The PPI test was conducted according to the previously published protocols [22,23]. The PPI test followed established protocols. Each PPI test session included three types of trials: non-stimulus, startle, and prepulse. Startle trials consisted of a single 120 dB startle pulse delivered for 40 ms. Prepulse trials involved a brief prepulse (3, 6, or 12 dB above background noise) lasting 20 ms, followed by a 120 dB startle pulse for 40 ms with an 80 ms delay. Non-stimulus trials included only the 70 dB background noise without additional stimuli. For pulse-alone trials (120 dB), five presentations were made between the acclimatization period and the end of each session, and each prepulse or non-stimulus trial was presented 10 times as pseudorandomly performed. The average non-stimulus trial period was 21 seconds (range: 12–30 s). The percentage score of each prepulse trial was calculated for the amount of PPI: %PPI=100-[(startle response for pulse-prepulse)/(startle response for pulse)]×100 (%).

Quantitative polymerase chain reaction assay

Total RNA was extracted from tissue samples using the RNeasy Mini Kit (Qiagen). Complementary DNA (cDNA) was synthesized from the extracted RNA using the DiaStar RT Kit (SolGent) with random hexamers (Invitrogen). Quantitative polymerase chain reaction (qPCR) was performed using a Real-Time PCR EvaGreen Kit (SolGent) and specific primers for each gene. Temperature cycling conditions for each primer consisted of 10 minutes at 95.0°C followed by 40 cycles for 15 seconds at 95.0°C and 1 minute at 60.0°C. The housekeeping gene Gapdh was used as an internal reference control. qPCR was performed using the StepOnePlus Real-Time PCR System (Applied Biosystems Inc.). The relative expressions of mRNA transcripts were calculated using the 2-ΔΔCT method. To confirm the amplification specificity of the PCR products, we used melting curve analysis after the completion of PCR cycling.

Participants

The study cohort comprised 159 Korean patients with schizophrenia, including 91 males and 68 females, with a mean age of 47.5 years (±10.4). Additionally, 448 healthy controls participated in the study, consisting of 207 males and 241 females, with a mean age of 55.1 years (±16.3). All participants were ethnically Korean and unrelated to each other. All patients were diagnosed with schizophrenia according to the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition. Experienced psychiatrists used all information from interviews and clinical records to establish the diagnosis. The control participants were recruited after being assessed as mentally healthy through a general health examination program. Written informed consent was obtained from all participants involved in the study, and the study design was approved by the Ethics Review Committee of the Medical Research Institute, Kyung Hee University Hospital in Seoul, Republic of Korea (KHSASP-20-279).

Clinical assessment

The Operational Criteria Checklist for Psychotic Illness (OPCRIT; McGuffin et al. [24],) was utilized to evaluate the lifetime psychotic symptoms of patients with schizophrenia, reflecting both the severity and chronicity of their symptoms. The OPCRIT, developed by experienced clinicians, is designed to capture the full spectrum of symptoms and clinical features throughout the illness. The OPCRIT focuses on the most prevalent psychiatric symptoms in schizophrenia, including delusions and hallucinations. Table 1 shows the clinical characteristics of patients with schizophrenia. Control participants were selected from individuals undergoing routine health checkups at the hospital. Hallucinations were confirmed based on symptoms 73–77 from the OPCRIT checklist, while delusions were identified based on symptoms 54–63, 69, 70, and 71.

Clinical characteristics of patients with schizophrenia and control participants

SNP selection and genotyping

SNPs of RSPO2 were selected from the National Center for Biotechnology Information SNP database (https://www.ncbi.nlm.nih.gov/gene/340419). SNPs with a minor allele frequency of ≥0.05 in Chinese and Japanese populations were sorted. No SNPs in the coding region met these criteria; therefore, common SNPs were selected from various regions of the gene, including exonic and regulatory regions. The final selection for further analysis included five common SNPs distributed across different gene regions: rs555008 (3' untranslated region, 3' UTR), rs601558 (non-synonymous coding variant, NONSYN), rs9297407 (intron), rs423940 (intron), and rs374810 (promoter region). Peripheral blood samples were obtained from participants using ethylenediaminetetraacetic acid tubes. SNP genotyping was performed via direct sequencing with the ABI PRISM 3730XL analyzer (PE Applied Biosystems).

Transfection and luciferase activity assay

We constructed both major and minor allele variants to evaluate the impact of rs374810 alleles on promoter activity in RSPO2. The 541-bp fragment in the 5'-upstream region of the human RSPO2 gene, including rs374810, was prepared by PCR using human genomic DNA purchased from Promega. The sequence of the primer (5'-3') was GAATCGGAATCAACTATATTAG CAATTAGAACCTGCCAAT.

The PCR product was cloned into a pCR2.1-TOPO TA vector (Thermo Fisher Scientific). The cloned PCR product was sequenced and confirmed as the major allele of rs374810 (the G allele). The mutant-type plasmid of the A allele was produced from the wild-type plasmid of the G allele through point mutation using a Phusion site-directed mutagenesis kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. The constructs were inserted using KpnI and XhoI sites into the upstream region of the pGL3-basic luciferase reporter vector (Promega).

SH-SY5Y human neuroblastoma cells were plated at a density of 1×105 cells per well in 24-well plates and cultured overnight in Dulbecco’s Modified Eagle’s Medium with 10% fetal bovine serum, 50 units/mL penicillin, and 50 μg/mL streptomycin. The cells were then transfected with 490 ng of each reporter construct and 10 ng of the pRL-TK vector, which expresses Renilla luciferase constitutively, using Lipofectamine LTX (Thermo Fisher Scientific). Following a 48-hour incubation, cells were lysed and luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) with a TD 20/20 Luminometer (Turner Design). The firefly luciferase activity was normalized to Renilla luciferase activity to account for transfection efficiency.

Statistical analysis

The results of the animal study are presented as mean± standard deviation (SD). Statistical analyses were performed using IBM SPSS Statistics 23 (IBM Corp.). Group differences were assessed with an unpaired t-test. Genotype frequencies were determined using SNPStats (http://bioinfo.iconcologia.net/index.php), and allele frequency comparisons were performed using a chi-square (χ2) test with Haploview 4.2 (Broad Institute). Associations between SNPs and schizophrenia were evaluated through multiple logistic regression analyses, which calculated odds ratios (ORs), 95% confidence intervals (CIs), and p-values, with adjustments for age and sex. The logistic regression analysis for each SNP used models assuming additive inheritance, dominant inheritance, and recessive inheritance. We also investigated possible associations between these polymorphisms and the clinical symptoms of schizophrenia. Data on luciferase activity are reported as mean±SD. Luciferase activity data are reported as mean±SD, with group differences analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s HSD post-hoc test. Statistical significance was determined with a threshold p-value of less than 0.05. The power resulting from our sample was calculated using the Genetic Power Calculator (https://zzz.bwh.harvard.edu/gpc/cc2.html), and we adjusted the effective sample size accordingly. The genotype distributions of the five SNPs were in Hardy-Weinberg equilibrium (HWE) (p>0.05).

RESULTS

PPI and genetic mouse models

We detected significant pre-pulse facilitation in MK-801-treated schizophrenic-like mice at low pre-pulse stimulus intensities, but there was no change in the startle response in the MK- 801-treated group (Figure 1A). We measured PPI using the acoustic startle response test in the MK-801-treated and control mice. The results showed significant differences in PPI between the groups. In a pre-pulse stimulus of 6 and 12 dB above the background, significant inhibition was observed in MK-801-treated mice compared with that in control mice (p<0.05). However, PPI was not significantly (p>0.05) different between the two groups at 3 dB above the background, with the stimulus sound at 70 dB above the background (Figure 1B).

Figure 1.

of MK-801 on startle amplitude and PPI test. A: PPI of the acoustic startle response in mice was tested using SRLAB startle chambers (San Diego Instruments). Pre-pulse facilitation in MK-801-treated schizophrenic-like mice at lower pre-pulse stimulus intensities showed no change in startle response in the MK-801-treated group. B: PPI using the acoustic startle response test in the MK-801-treated and Con mice. Significant inhibition was observed in MK-801-treated mice in pre-pulse stimulus 6 and 12 dB above the background (p<0.05). PPI was not significantly (p>0.05) different between the two groups at 3 dB above the background, with stimulus sound at 70 dB above the background. PPI, pre-pulse inhibition; Con, control; NS, not significant.

mRNA expression of Rspo2 in the brain of MK-801-treated schizophrenic-like mice

To investigate whether expression levels of Rspo2 were changed in schizophrenic-like mice brains, the mRNA expression of Rspo2 was measured in the prefrontal cortex, hippocampus, and striatum of MK-801-treated and control mice (n=4 in each group). In the prefrontal cortex, hippocampus, and striatum of MK-801-treated mice, the mRNA expression of Rspo2 was significantly increased (Figure 2). We speculated that RSPO2 might be involved in the pathophysiology of schizophrenia, considering its changed expression levels. We, therefore, extended our study to human participants.

Figure 2.

mRNA expression of RSPO2 in the brain of MK-801-treated mice. Each bar represents mean±standard deviation. Values were considered statistically significant when p<0.05. The mRNA expression of the RSPO2 was measured in the prefrontal cortex of MK- 801-treated mice. Real-time quantitative PCR was used to analyze the mRNA levels in the prefrontal cortex. mRNA expression of RSPO2 was significantly increased. Con, control.

Genetic association between RSPO2 and patients with schizophrenia

The genotype distributions of the SNPs were in HWE (p>0.05). In the analysis of the associations between the five SNPs of RSPO2 and schizophrenia, rs374810 and rs423940 showed significant associations with schizophrenia. The allele frequency of rs374810 was significantly associated with schizophrenia (p=0.0049); the rs374810 A allele frequency in the schizophrenia group (55.0%) was higher than that in the control group (46.0%), reflecting a higher frequency of the A allele in patients with schizophrenia. The allele frequency of rs423940 was also associated with schizophrenia (p=0.0044); the rs423940 T allele frequency in the schizophrenia group (55.0%) was higher than that in the control group (45.0%). We found no association between the other SNPs (rs9297407, rs601558, and rs555008) and the risk of schizophrenia (Table 2).

Genotype and allele frequencies of the RSPO2 polymorphisms in patients with SCZ and control participants

The genotype distribution of rs374810 was different between patients with schizophrenia and control participants (OR=1.60, 95% CI=1.02–2.49, p=0.034 in the dominant model [A/G-A/A vs. G/G]; OR=1.63, 95% CI=1.07–2.48, p=0.024 in the recessive model [A/A vs. G/G-A/G]; OR=1.43, 95% CI=1.10–1.86, p=0.008 in the additive model [A/A vs. A/G vs. G/G]) (Table 2). The genotype distribution of rs423940 was also significantly different between patients with schizophrenia and control participants (OR=1.60, 95% CI=1.02–2.49, p=0.034 in the dominant model [C/T-T/T vs. C/C]; OR=1.65, 95% CI=1.08–2.51, p=0.021 in the recessive model [T/T vs. C/C-C/T]; OR=1.44, 95% CI=1.10–1.87, p=0.007 in the additive model [C/C vs. C/T vs. T/T]) (Table 2). Regarding rs374810 and rs423940, genotypes carrying the A and T alleles, respectively, were associated with an increased risk of developing schizophrenia.

In addition, we conducted a power analysis using the Genetic Power Calculator (https://zzz.bwh.harvard.edu/gpc/cc2.html). The genotype distributions of the five SNPs were confirmed to be in HWE (p>0.05). Assuming a 1.7-fold genotype relative risk, the sample powers for rs374810 and rs423940 were 0.743 (effective sample size needed for 80% power=180) and 0.736 (n=185), respectively. For rs601558, rs555008, and rs9297407, the sample powers were lower, at 0.612 (n=260), 0.507 (n=300), and 0.487 (n=320), respectively. Under a 1.5-fold relative risk assumption, the sample powers decreased to approximately 0.583 for rs374810 and 0.575 for rs423940. Therefore, our study had sufficient power and sample size to detect moderate to high genotype relative risks (≥1.7-fold) for the primary SNPs rs374810 and rs423940, supporting the reliability of the observed associations.

Genetic association of RSPO2 with the clinical symptoms of schizophrenia

The association between SNPs of RSPO2 and clinical symptoms (hallucinations and delusions) was analyzed. In the analysis between RSPO2 and OPCRIT factors, rs374810 and rs423940 were associated with hallucinations (rs374810: OR=0.35, 95% CI=0.16–0.77, p=0.009 in the recessive model [G/G vs. A/A-A/G]; OR=0.60, 95% CI=0.3–0.98, p=0.038 in the additive model [A/A vs. A/G vs. G/G]; rs423940: OR=0.35, 95% CI=0.16–0.77, p=0.009 in the recessive model [C/C vs. T/T-C/T]; OR=0.60, 95% CI=0.36–0.98, p=0.038 in the additive model [C/C vs. C/T vs. T/T]) (Table 3). The frequency of the A/A genotype on rs374810 and the T/T genotype on rs423940 was significantly higher in patients with schizophrenia with hallucinations than in those without hallucinations. In the analysis between SNPs and OPCRIT items related to delusions, the genotype distribution of rs601558 differed between patients with schizophrenia with and without delusions (OR=0.14, 95% CI=0.03–0.57, p=0.011 in the recessive model [A/A vs. G/G-A/G]; OR=0.31, 95% CI=0.11–0.87, p=0.021 in the additive model [A/A vs. A/G vs. G/G]) (Table 4).

Genotype distribution of polymorphisms of the RSPO2 gene in patients with schizophrenia with and without hallucination

Genotype distribution of polymorphisms of the RSPO2 gene in patients with schizophrenia with and without delusion

Haplotype analyses

In the haplotype analysis, four haplotypes of RSPO2, namely, AGACG, AGATA, AAATA, and CAACG, were detected as common haplotypes with a frequency of >0.05. In the association analysis between haplotypes and schizophrenia, AAATA was significantly associated with schizophrenia (OR=1.71, 95% CI=1.15–2.54, p=0.008) (Table 5). This result indicates that the AAATA haplotype of RSPO2 contributes to an increased risk of schizophrenia.

Analysis of haplotypes consisting of RSPO2 polymorphisms in patients with SCZ and Con participants

Functional study on a promoter SNP of RSPO2

After that, we used a luciferase reporter system to assess the effect of the promoter activity according to the alleles of rs374810 in RSPO2 (Figure 3). One-way ANOVA showed a significant difference in the promoter activity between groups (p<0.01). In the pos-hoc test, the insertion of the RSPO2 putative promoter fragment in the pGL-basic vector increased the promoter activity of both fragments, including the G (the major allele) and A allele (minor allele) of rs374810, compared to that in the pGL-basic vector without the inserted fragment (p<0.001 on both alleles). This indicates that the RSPO2 putative promoter fragment could function as a promoter. In addition, the promoter activity of the A allele of rs374810 was increased compared to that of the G allele. This result indicates that the A allele of rs374810 leads to upregulation of RSPO2 transcription through increased promoter activity.

Figure 3.

Effect of the rs374810 of RSPO2 on the promotor activity. The promoter activity of the promotor SNP rs374810 of RSPO2 according to the alleles was measured using luciferase reporter system. The promotor activity of the minor allele of rs374810 (the A allele) was shown to be increased, compared to the major allele (the G allele).

To further investigate the functional implications of the AAATA haplotype, which is significantly associated with an increased risk of schizophrenia, we performed a transcription factor binding site prediction using Alibaba 2.1 (http://www.gene-regulation.com/pub/programs/alibaba2) [25]. Among the SNPs comprising the haplotype, rs374810 showed allele-specific binding differences. The G allele sequence was predicted to bind MIG1, NF-κB, and SP1, whereas the A allele sequence introduced an additional SP1 binding motif and lost MIG1 binding.

DISCUSSION

In the present study, we explored the potential associations between RSPO2 polymorphisms and schizophrenia in the Korean population. The A allele of rs374810 was associated with an increased risk of schizophrenia. In the haplotype analysis, the AAATA haplotype was significantly associated with schizophrenia. Moreover, the mRNA expression of RSPO2 showed a significant increase in the prefrontal cortex, hippocampus, and striatum of the MK-801-treated mice. The luciferase reporter system showed that the promoter activity was increased in the A allele of rs374810 in RSPO2, compared to the G allele. These results indicate that the minor allele (the A allele) of rs374810 and the AAATA haplotype may play a role in increased RSPO2 transcription.

The neurodevelopmental theory of schizophrenia is a widely accepted theory, which states that early dysregulation of brain development causes schizophrenia. One of the critical brain developmental signaling pathways is the WNT pathway. The Wnt signaling pathway, which is involved in neuronal proliferation, synapse formation, and migration, has been proposed to cause cytoarchitectural defects in the schizophrenic brain [11,12,26]. Although the exact mechanism of the Wnt signaling pathway in schizophrenia remains unclear, previous studies have suggested an important role of the pathway in the pathogenesis of schizophrenia. The role of the WNT pathway in neuronal migration suggests its involvement in the cytoarchitectural defect in schizophrenia [12]. Patients with schizophrenia and cognitive deficits have shown a significant down-regulation of Wnt signaling pathway [27].

Among the Wnt signaling pathway-related genes, RSPO2 is the upstream key regulatory ligand for the Wnt signaling pathway. RSPO2, a member of the R-spondin family, acts as a potent enhancer of the canonical Wnt/β-catenin pathway by binding to LGR4/5 receptors and stabilizing the Frizzled-LRP6 complex, thereby amplifying β-catenin–mediated transcription [20]. This amplification is crucial for cortical layering, neuronal proliferation, axon guidance, and synapse formation during brain development [9,11,12]. In our study, we observed increased RSPO2 expression in MK-801-treated mice, a pharmacological model of schizophrenia. This may reflect either a compensatory response to glutamatergic dysfunction or a maladaptive hyperactivation of Wnt signaling [6,12]. These findings support the hypothesis that RSPO2 plays a critical neurodevelopmental role in schizophrenia.

The RSPO family participates in a wide range of physiological and developmental processes. RSPO2 mutations are associated with genetic diseases and cancer. Additionally, RSPO2 is essential in laryngeal-tracheal, limb, and lung development [28,29]. In a genome-wide association study, the gene locus was linked to genetic susceptibility in Dupuytren’s disease, a benign fibromatosis [30]. Moreover, aberrant RSPO2 expression has been implicated in the oncogenesis of several types of cancers, including pancreatic, colorectal, breast, and gastric cancers [31-34]. Also, RSPO2 may play an essential role in the pathophysiology of neuropsychiatric diseases. By analyzing the temporal cortex of the human post-mortem brain, one study showed that WNT1 and RSPO2 expressions were significantly downregulated in brains with Alzheimer’s disease [35].

In the present study, we found that Rspo2 might play an important role in the neurodevelopmental process of schizophrenia. In a MK-801-treated schizophrenic mice model, we measured the mRNA expression levels of RSPO2 in the brain to evaluate its involvement in schizophrenia. Intriguingly, mRNA expression of Rspo2 was increased in all brain regions (prefrontal cortex, hippocampus, and striatum). One study showed that MK-801 also affects sensorimotor behaviors in rodents, along with changes in the dopamine and glutamate systems [36]. In previous studies, Rspo2 gene expression was detected in the epithelial cells of the dorsal neural tube of mouse embryos [28]. In Rspo2 knockout mice, multiple abnormalities, including distal limb, lung, and craniofacial morphogenesis, were noted during embryonic organogenesis [37]. These findings indicate that Rspo2 regulates midfacial, limb, and lung morphogenesis during neurodevelopment through WNT/β-catenin signaling, which might be involved in the pathophysiological mechanisms of schizophrenia.

We found that the A allele of the promoter SNP rs374820 in RSPO2 was significantly associated with an increased risk of schizophrenia. In the haplotype analysis, the AAATA haplotype was also significantly associated with schizophrenia. In the functional study, the luciferase activity assay showed that the minor A allele in rs374820 could increase the promoter activity compared with that of the major G allele. The A allele of rs374810 may enhance transcriptional activity via increased SP1 binding motif and lost MIG1 binding [25]. This shift may increase RSPO2 promoter activity via enhanced SP1 interaction, which is consistent with our luciferase assay results showing higher activity for the A allele. These findings suggest that the AAATA haplotype may promote RSPO2 transcription by modulating transcription factor binding affinity. The remaining SNPs in the haplotype are located in noncoding regions and may contribute to gene regulation through mechanisms such as modulation of chromatin structure, alteration of splicing, or changes in RNA stability [38-40]. Although each SNP alone may have a limited impact, their combined presence in the AAATA haplotype may exert a synergistic regulatory effect on RSPO2 expression.

Thus, patients with schizophrenia may have higher transcription levels of RSPO2 due to a higher promoter activity. Although it is not known whether schizophrenia causes an increase in RSPO2 expression or if an increase in RSPO2 expression induces schizophrenia, the increase in RSPO2 expression may be more prominent in patients with the A allele in rs374820, due to a higher promoter activity of RSPO2 than that in those with the G allele. These results indicate that the increase in RSPO2 expression may contribute to the pathology of schizophrenia. Therefore, the A allele of rs374820 in RSPO2 may be related to the severity of schizophrenia.

This study had several limitations. The major limitation was the small sample size; therefore, some type I errors may have existed. Further validations in larger samples should be required. Secondly, the participants were restricted to the Korean population. Third, we didn’t analyze all the genetic variants in the Wnt signaling pathway. Nevertheless, an additional analysis of variants in another region in these genes could reveal the role of the RSPO2 gene polymorphisms to susceptibility to schizophrenia. Despite these limitations, this study proposed RSPO2 as the new candidate gene for schizophrenia and detected the activity of the promoter SNP of the gene. Our findings indicate that RSPO2 may increase the risk of schizophrenia by disrupting the Wnt signaling pathway. Future research studies using cellular and animal models are needed to fully determine the role of RSPO2 in the pathophysiology of schizophrenia.

In conclusion, rs374810, the promoter SNP of RSPO2 in the Wnt signaling pathway, is associated with the pathophysiology of schizophrenia. RSPO2 expression may be associated with the susceptibility to schizophrenia in the Korean population.

Notes

Availability of Data and Material

The datasets generated or analyzed during the study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors have no potential conflicts of interest to disclose.

Author Contributions

Conceptualization: Hae Jeong Park, Jong Woo Kim. Data curation: Ah Rah Lee. Formal analysis: Ah Rah Lee, Hae Jeong Park. Methodology: Ah Rah Lee, Hae Jeong Park. Resources: Jong Woo Kim. Supervision: Won Sub Kang. Validation: Won Sub Kang. Writing—original draft: Ah Rah Lee, Hae Jeong Park. Writing—review & editing: Won Sub Kang, Jong Woo Kim.

Funding Statement

None

Acknowledgments

None

References

1. Fatemi SH, Folsom TD. The neurodevelopmental hypothesis of schizophrenia, revisited. Schizophr Bull 2009;35:528–548.
2. Matheson SL, Shepherd AM, Laurens KR, Carr VJ. A systematic meta-review grading the evidence for non-genetic risk factors and putative antecedents of schizophrenia. Schizophr Res 2011;133:133–142.
3. Cannon M, Caspi A, Moffitt TE, Harrington H, Taylor A, Murray RM, et al. Evidence for early-childhood, pan-developmental impairment specific to schizophreniform disorder: results from a longitudinal birth cohort. Arch Gen Psychiatry 2002;59:449–456.
4. Woodberry KA, Giuliano AJ, Seidman LJ. Premorbid IQ in schizophrenia: a meta-analytic review. Am J Psychiatry 2008;165:579–587.
5. Chien YL, Wu YY, Chiu YN, Liu SK, Tsai WC, Lin PI, et al. Association study of the CNS patterning genes and autism in Han Chinese in Taiwan. Prog Neuropsychopharmacol Biol Psychiatry 2011;35:1512–1517.
6. Hoseth EZ, Krull F, Dieset I, Mørch RH, Hope S, Gardsjord ES, et al. Exploring the Wnt signaling pathway in schizophrenia and bipolar disorder. Transl Psychiatry 2018;8:55.
7. Marui T, Funatogawa I, Koishi S, Yamamoto K, Matsumoto H, Hashimoto O, et al. Association between autism and variants in the wingless-type MMTV integration site family member 2 (WNT2) gene. Int J Neuropsychopharmacol 2010;13:443–449.
8. Owen MJ, O’Donovan MC. Schizophrenia and the neurodevelopmental continuum:evidence from genomics. World Psychiatry 2017;16:227–235.
9. Noelanders R, Vleminckx K. How Wnt signaling builds the brain: bridging development and disease. Neuroscientist 2017;23:314–329.
10. Woodhead GJ, Mutch CA, Olson EC, Chenn A. Cell-autonomous β-catenin signaling regulates cortical precursor proliferation. J Neurosci 2006;26:12620–12630.
11. Okerlund ND, Cheyette BN. Synaptic Wnt signaling-a contributor to major psychiatric disorders? J Neurodev Disord 2011;3:162–174.
12. Panaccione I, Napoletano F, Forte AM, Kotzalidis GD, Del Casale A, Rapinesi C, et al. Neurodevelopment in schizophrenia: the role of the wnt pathways. Curr Neuropharmacol 2013;11:535–558.
13. Inestrosa NC, Arenas E. Emerging roles of Wnts in the adult nervous system. Nat Rev Neurosci 2010;11:77–86.
14. Miyaoka T, Seno H, Ishino H. Increased expression of Wnt-1 in schizophrenic brains. Schizophr Res 1999;38:1–6.
15. Faraone SV, Matise T, Svrakic D, Pepple J, Malaspina D, Suarez B, et al. Genome scan of European-American schizophrenia pedigrees: results of the NIMH Genetics Initiative and Millennium Consortium. Am J Med Genet 1998;81:290–295.
16. Yang J, Si T, Ling Y, Ruan Y, Han Y, Wang X, et al. Association study of the human FZD3 locus with schizophrenia. Biol Psychiatry 2003;54:1298–1301.
17. Proitsi P, Li T, Hamilton G, Di Forti M, Collier D, Killick R, et al. Positional pathway screen of wnt signaling genes in schizophrenia: association with DKK4. Biol Psychiatry 2008;63:13–16.
18. Stefansson H, Ophoff RA, Steinberg S, Andreassen OA, Cichon S, Rujescu D, et al. Common variants conferring risk of schizophrenia. Nature 2009;460:744–747.
19. Li J, Zhou G, Ji W, Feng G, Zhao Q, Liu J, et al. Common variants in the BCL9 gene conferring risk of schizophrenia. Arch Gen Psychiatry 2011;68:232–240.
20. Carmon KS, Gong X, Lin Q, Thomas A, Liu Q. R-spondins function as ligands of the orphan receptors LGR4 and LGR5 to regulate Wnt/β-catenin signaling. Proc Natl Acad Sci U S A 2011;108:11452–11457.
21. Gyllborg D, Ahmed M, Toledo EM, Theofilopoulos S, Yang S, Ffrench-Constant C, et al. The matricellular protein R-Spondin 2 promotes midbrain dopaminergic neurogenesis and differentiation. Stem Cell Reports 2018;11:651–664.
22. Jeong Y, Bae HJ, Park K, Bae HJ, Yang X, Cho YJ, et al. 4-Methoxycinnamic acid attenuates schizophrenia-like behaviors induced by MK-801 in mice. J Ethnopharmacol 2022;285:114864.
23. Park SJ, Lee Y, Oh HK, Lee HE, Lee Y, Ko SY, et al. Oleanolic acid attenuates MK-801-induced schizophrenia-like behaviors in mice. Neuropharmacology 2014;86:49–56.
24. McGuffin P, Farmer A, Harvey I. A polydiagnostic application of operational criteria in studies of psychotic illness. Development and reliability of the OPCRIT system. Arch Gen Psychiatry 1991;48:764–770.
25. Qi T, Wu Y, Zeng J, Zhang F, Xue A, Jiang L, et al. Identifying gene targets for brain-related traits using transcriptomic and methylomic data from blood. Nat Commun 2018;9:2282.
26. Martin PM, Stanley RE, Ross AP, Freitas AE, Moyer CE, Brumback AC, et al. DIXDC1 contributes to psychiatric susceptibility by regulating dendritic spine and glutamatergic synapse density via GSK3 and Wnt/β-catenin signaling. Mol Psychiatry 2018;23:467–475.
27. Wu JQ, Green MJ, Gardiner EJ, Tooney PA, Scott RJ, Carr VJ, et al. Altered neural signaling and immune pathways in peripheral blood mononuclear cells of schizophrenia patients with cognitive impairment: a transcriptome analysis. Brain Behav Immun 2016;53:194–206.
28. Kim KA, Zhao J, Andarmani S, Kakitani M, Oshima T, Binnerts ME, et al. R-Spondin proteins: a novel link to β-catenin activation. Cell Cycle 2006;5:23–26.
29. Nam JS, Turcotte TJ, Yoon JK. Dynamic expression of R-spondin family genes in mouse development. Gene Expr Patterns 2007;7:306–312.
30. Dolmans GH, Werker PM, Hennies HC, Furniss D, Festen EA, Franke L, et al. Wnt signaling and Dupuytren’s disease. N Engl J Med 2011;365:307–317.
31. Ilmer M, Boiles AR, Regel I, Yokoi K, Michalski CW, Wistuba II, et al. RSPO2 enhances canonical Wnt signaling to confer stemness-associated traits to susceptible pancreatic cancer cells. Cancer Res 2015;75:1883–1896.
32. Klauzinska M, Baljinnyam B, Raafat A, Rodriguez-Canales J, Strizzi L, Greer YE, et al. Rspo2/Int7 regulates invasiveness and tumorigenic properties of mammary epithelial cells. J Cell Physiol 2012;227:1960–1971.
33. Seshagiri S, Stawiski EW, Durinck S, Modrusan Z, Storm EE, Conboy CB, et al. Recurrent R-spondin fusions in colon cancer. Nature 2012;488:660–664.
34. Wilhelm F, Simon E, Böger C, Behrens HM, Krüger S, Röcken C. Novel insights into gastric cancer: methylation of R-spondins and regulation of LGR5 by SP1. Mol Cancer Res 2017;15:776–785.
35. Macyczko JR, Wang N, Zhao J, Ren Y, Lu W, Ikezu TC, et al. Suppression of Wnt/β-catenin signaling is associated with downregulation of Wnt1, PORCN, and Rspo2 in Alzheimer’s disease. Mol Neurobiol 2023;60:26–35.
36. Al-Amin HA, Saadé NE, Khani M, Atweh S, Jaber M. Effects of chronic dizocilpine on acute pain and on mRNA expression of neuropeptides and the dopamine and glutamate receptors. Brain Res 2003;981:99–107.
37. Yamada W, Nagao K, Horikoshi K, Fujikura A, Ikeda E, Inagaki Y, et al. Craniofacial malformation in R-spondin2 knockout mice. Biochem Biophys Res Commun 2009;381:453–458.
38. Zhao C, Xu Z, Wang F, Chen J, Ng SK, Wong PW, et al. Alternative-splicing in the exon-10 region of GABA(A) receptor β2 subunit gene: relationships between novel isoforms and psychotic disorders. PLoS One 2009;4:e6977.
39. Zhao C, Wang F, Pun FW, Mei L, Ren L, Yu Z, et al. Epigenetic regulation on GABRB2 isoforms expression: developmental variations and disruptions in psychotic disorders. Schizophr Res 2012;134:260–266.
40. Law AJ, Lipska BK, Weickert CS, Hyde TM, Straub RE, Hashimoto R, et al. Neuregulin 1 transcripts are differentially expressed in schizophrenia and regulated by 5’ SNPs associated with the disease. Proc Natl Acad Sci U S A 2006;103:6747–6752.

Article information Continued

Figure 1.

of MK-801 on startle amplitude and PPI test. A: PPI of the acoustic startle response in mice was tested using SRLAB startle chambers (San Diego Instruments). Pre-pulse facilitation in MK-801-treated schizophrenic-like mice at lower pre-pulse stimulus intensities showed no change in startle response in the MK-801-treated group. B: PPI using the acoustic startle response test in the MK-801-treated and Con mice. Significant inhibition was observed in MK-801-treated mice in pre-pulse stimulus 6 and 12 dB above the background (p<0.05). PPI was not significantly (p>0.05) different between the two groups at 3 dB above the background, with stimulus sound at 70 dB above the background. PPI, pre-pulse inhibition; Con, control; NS, not significant.

Figure 2.

mRNA expression of RSPO2 in the brain of MK-801-treated mice. Each bar represents mean±standard deviation. Values were considered statistically significant when p<0.05. The mRNA expression of the RSPO2 was measured in the prefrontal cortex of MK- 801-treated mice. Real-time quantitative PCR was used to analyze the mRNA levels in the prefrontal cortex. mRNA expression of RSPO2 was significantly increased. Con, control.

Figure 3.

Effect of the rs374810 of RSPO2 on the promotor activity. The promoter activity of the promotor SNP rs374810 of RSPO2 according to the alleles was measured using luciferase reporter system. The promotor activity of the minor allele of rs374810 (the A allele) was shown to be increased, compared to the major allele (the G allele).

Table 1.

Clinical characteristics of patients with schizophrenia and control participants

Schizophrenia (N=159) Control (N=448)
Male/female 91/68 207/241
Age (yr) 47.5±10.4 55.1±16.3
 Male 47.6±10.4 53.3±15.4
 Female 47.4±10.4 56.6±17.0
Delusion (absent/present) 9/150 -
Hallucination (absent/present) 47/112 -

Values are presented as number only or mean±standard deviation.

-, not applicable.

Table 2.

Genotype and allele frequencies of the RSPO2 polymorphisms in patients with SCZ and control participants

SNP Model/allele Genotype Control SCZ OR (95% CI) p
rs374810 (promoter) Dominant G/G 136 (30.4) 33 (20.8) 1 0.034*
A/G-A/A 312 (69.6) 126 (79.2) 1.60 (1.02–2.49)*
Recessive G/G-A/G 352 (78.6) 111 (69.8) 1 0.024*
A/A 96 (21.4) 48 (30.2) 1.63 (1.07–2.48)*
Additive A/A 96 (21.0) 48 (30.3)
A/G 216 (48.0) 78 (49.0)
G/G 136 (30.0) 33 (21.0) 1.43 (1.10–1.86)* 0.008*
Allele G 488 (54.0) 144 (45.0) 1 0.005*
A 408 (46.0) 174 (55.0)
rs423940 (intron) Dominant C/C 136 (30.4) 33 (20.8) 1 0.034*
C/T-T/T 312 (69.6) 126 (79.2) 1.60 (1.02–2.49)*
Recessive C/C-C/T 353 (78.8) 111 (69.8) 1 0.021*
T/T 95 (21.2) 48 (30.2) 1.65 (1.08–2.51)*
Additive C/C 136 (30.0) 33 (21.0)
C/T 217 (48.0) 78 (49.0)
T/T 95 (21.0) 48 (30.0) 1.44 (1.10–1.87)* 0.007*
Allele C 489 (55.0) 144 (45.0) 1 0.004*
T 407 (45.0) 174 (55.0)
rs9297407 (intron) - A/A 440 (98.0) 153 (96.0) 1 0.096
A/G 8 (2.0) 6 (4.0) 2.66 (0.87–8.18)
Allele A 888 (99.0) 312 (98.0) 1 0.154
G 8 (1.0) 6 (2.0)
rs601558 (NONSYN) Dominant G/G 191 (42.6) 64 (40.2) 1 0.31
A/G-A/A 257 (57.4) 95 (59.8) 1.22 (0.83–1.78)
Recessive G/G-A/G 409 (91.3) 140 (88.0) 1 0.15
A/A 39 (8.7) 19 (11.9) 1.57 (0.86–2.86)
Additive A/A 39 (9.0) 19 (12.0)
A/G 218 (49.0) 76 (48.0)
G/G 191 (43.0) 64 (40.0) 1.24 (0.93–1.65) 0.15
Allele G 600 (67.0) 204 (64.0) 1 0.362
A 296 (33.0) 114(36.0)
rs555008 (3UTR) Dominant A/A 329 (73.4) 123 (77.4) 1 0.39
A/C-C/C 119 (26.6) 36 (22.6) 0.83 (0.53–1.28)
Recessive A/A-A/C 444 (99.1) 158 (99.4) 1 0.75
C/C 4 (0.9) 1 (0.6) 0.70 (0.07–6.68)
Additive A/A 329 (73.0) 123 (77.0)
A/C 115 (26.0) 35 (22.0)
C/C 4 (1.0) 1 (1.0) 0.83 (0.55–1.26) 0.40
Allele A 773 (86.0) 281 (88.0) 1 0.343
G 123 (14.0) 37 (12.0)

Values are presented as number (%).

*

indicates a significant association.

SNP, single nucleotide polymorphism; SCZ, schizophrenia; OR, odds ratio; CI, confidence interval; RSPO2, R-spondin 2; -, not applicable.

Table 3.

Genotype distribution of polymorphisms of the RSPO2 gene in patients with schizophrenia with and without hallucination

SNP (location) Model/allele Genotype Without With OR (95% CI) p
rs374810 (promoter) Dominant A/A 12 (25.5) 36 (32.1) 1 0.40
A/G-G/G 35 (74.5) 76 (67.9) 0.72 (0.34–1.56)
Recessive A/A-A/G 31 (66.0) 95 (84.8) 1 0.009*
G/G 16 (34.0) 17 (15.2) 0.35 (0.16–0.77)*
Additive A/A 12 (26.0) 36 (32.0)
A/G 19 (40.0) 59 (53.0)
G/G 16 (33.0) 17 (15.0) 0.60 (0.36–0.98)* 0.038*
Allele A 43 (46.0) 131 (58.0) 1
G 51 (54.0) 93 (42.0)
rs423940 (intron) Dominant T/T 12 (25.5) 36 (32.1) 1 0.40
C/T-C/C 35 (74.5) 76 (67.9) 0.72 (0.34–1.56)
Recessive T/T-C/T 31 (66.0) 95 (84.8) 1 0.009*
C/C 16 (34.0) 17 (15.2) 0.35 (0.16–0.77)*
Additive C/C 16 (34.0) 17 (15.0)
C/T 19 (40.0) 59 (53.0)
T/T 12 (26.0) 36 (32.0) 0.60 (0.36–0.98)* 0.038*
Allele T 43 (46.0) 131(58.0) 1
C 51 (54.0) 93 (42.0)
rs9297407 (intron) NA A/A 43 (91.0) 110 (98.0) 1 0.055
A/G 4 (9.0) 2 (2.0) 0.20 (0.03–1.11)
Allele A 90 (96.0) 222 (99.0) 1 0.154
G 4 (4.0) 2 (1.0)
rs601558 (NONSYN) Dominant G/G 21 (44.7) 43 (38.4) 1 0.46
A/G-A/A 26 (55.3) 69 (61.6) 1.30 (0.65–2.58)
Recessive G/G-A/G 42 (89.4) 98 (87.5) 1 0.74
A/A 5 (10.6) 14 (12.5) 1.20 (0.41–3.55)
Additive A/A 5 (11.0) 14 (12.0)
A/G 21 (45.0) 55 (49.0)
G/G 21 (45.0) 43 (38.0) 1.21 (0.72–2.03) 0.48
Allele G 63 (67.0) 141 (63.0) 1 0.362
A 31 (33.0) 83 (37.0)
rs555008 (3UTR) Dominant A/A 38 (80.8) 85 (75.9) 1 0.49
A/C-C/C 9 (19.1) 27 (24.1) 1.34 (0.58–3.12)
Recessive A/A-A/C 47 (100) 111 (99.1) 1 0.40
C/C 0 (0) 1 (0.9) NA (0.00–NA)
Additive A/A 38 (81.0) 85 (76.0)
A/C 9 (19.0) 26 (23.0)
C/C 0 (0) 1 (1.0) 1.38 (0.61–3.13) 0.43
Allele A 85 (90.0) 196 (88.0) 1 0.343
C 9 (10.0) 28 (12.0)

Values are presented as number (%).

*

indicates a significant association.

SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; RSPO2, R-spondin 2; NA, not applicable.

Table 4.

Genotype distribution of polymorphisms of the RSPO2 gene in patients with schizophrenia with and without delusion

SNP (location) Model/allele Genotype Without With OR (95% CI) p
rs374810 (promoter) Dominant A/A 2 (22.2) 46 (30.7) 1 0.58
A/G-G/G 7 (77.8) 104 (69.3) 0.65 (0.13–3.23)
Recessive A/A-A/G 6 (66.7) 120 (80.0) 1 0.36
G/G 3 (33.3) 30 (20.0) 0.50 (0.12–2.12)
Additive A/A 2 (22.0) 46 (31.0)
A/G 4 (44.0) 74 (49.0)
G/G 3 (33.0) 30 (20.0) 0.65 (0.25–1.69) 0.37
Allele A 8 (44.0) 166 (55.0) 1
G 10 (56.0) 134 (45.0)
rs423940 (intron) Dominant T/T 2 (22.2) 46 (30.7) 1 0.058
C/T-C/C 7 (77.8) 104 (69.3) 0.65 (0.13–3.23)
Recessive T/T-C/T 6 (66.7) 120 (80.0) 1 0.36
C/C 30 (33.3) 30 (20.0) 0.50 (0.12–2.12)
Additive C/C 3 (33.0) 30 (20.0)
C/T 4 (44.0) 74 (49.0)
T/T 2 (22.0) 46 (31.0) 0.65 (0.25–1.69) 0.37
Allele T 8 (44.0) 166 (55.0) 1
C 10 (56.0) 134 (45.0)
rs9297407 (intron) NA A/A 7 (78.0) 146 (97.0) 1* 0.031*
A/G 2 (22.0) 4 (3.0) 0.10 (0.01–0.62)*
Allele A 16 (89.0) 296 (99.0) 1 0
G 2 (11.0) 4 (1.0)
rs601558 (NONSYN) Dominant G/G 2 (22.2) 62 (41.3) 1 0.24
A/G-A/A 7 (77.8) 88 (58.7) 0.41 (0.08–2.02)
Recessive G/G-A/G 5 (55.6) 135 (90.0) 1* 0.011*
A/A 4 (44.4) 15 (10.0) 0.14 (0.03–0.57)*
Additive A/A 4 (44.0) 15 (10.0)
A/G 3 (43.0) 73 (49.0)
G/G 2 (22.0) 62 (41.0) 0.31 (0.11–0.87)* 0.021*
Allele G 7 (39.0) 197 (66.0) 1*
A 11 (61.0) 103 (34.0)
rs555008 (3UTR) Dominant A/A 5 (55.6) 118 (78.7) 1 0.14
A/C-C/C 4 (44.4) 32 (21.3) 0.34 (0.09–1.34)
Recessive A/A-A/C 9 (100) 149 (99.3) 1 0.73
C/C 0 (0) 1 (0.7) NA (0.00–NA)
Additive A/A 5 (56.0) 118 (79.0)
A/C 4 (44.0) 31 (21.0)
C/C 0 (0) 1 (1.0) 0.39 (0.11–1.39) 0.085
Allele A 14 (78.0) 267 (89.0) 1
C 4 (22.0) 33 (11.0)

Values are presented as number (%).

*

indicates a significant association.

SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; RSPO2, R-spondin 2; NA, not applicable.

Table 5.

Analysis of haplotypes consisting of RSPO2 polymorphisms in patients with SCZ and Con participants

rs555008 rs601558 rs9297407 rs423940 rs374810 Con Freq SCZ Freq OR (95% CI) p
A G A C G 0.3908 0.3219 1 -
A G A T A 0.2707 0.3067 1.36 (0.95–1.95) 0.096
A A A T A 0.1501 0.2013 1.71 (1.15–2.54)* 0.008*
C A A C G 0.1052 0.0759 0.96 (0.54–1.71) 0.89
A A A C G 0.0421 0.0349 1.16 (0.45–2.97) 0.76
C A A T A 0.0229 0.0275 1.29 (0.39–4.25) 0.67
*

indicates a significant association.

Con, control participants; SCZ, schizophrenia; Freq, frequency; OR, odds ratio; CI, confidence interval; RSPO2, R-spondin 2; -, not applicable.